View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21280_low_14 (Length: 453)
Name: NF21280_low_14
Description: NF21280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21280_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 310; Significance: 1e-174; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 114 - 442
Target Start/End: Complemental strand, 26898290 - 26897962
Alignment:
| Q |
114 |
gaagcaatgtattttaattgttgccaattgccatgtgagttcacatgtaaatgcaatactggttattgtatttctttgaatccccaattcttttaactaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
26898290 |
gaagcaatgtattttaattgttgccaattgccatgtgagttcacatgtaaatgcaatattggttattgtatttctttgaatccccaattcttt-aactaa |
26898192 |
T |
 |
| Q |
214 |
gttgtagaatttaaaatgtgaaatagtgtttttactttgcagtgaaatagtgtttttcatgtgaaatatattttaacggtttatttttt-gggtggtacc |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
26898191 |
gttgtagaatttaaaatgtgaaatagtgtttttactttgcagtgaaatagtgtttttcatgtgaaatatattttaacggtttatttttttgggtggtacc |
26898092 |
T |
 |
| Q |
313 |
agagtggtgttcatcatgcagtaaatccagacccttacagaggtctttttggctctgatggagcgaagtatgcaagagatgtccaagagatcattaactt |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26898091 |
agagtggtgttcatcatgcagtaaatccagacccttacagaggtctttttggctctgatggagcgaagtatgcaagagatgtccaagagatcattaactt |
26897992 |
T |
 |
| Q |
413 |
tggaacctccggaaatgttgctgcattcat |
442 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
26897991 |
tggaacctccggaaatgttgctgcattcat |
26897962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 18 - 49
Target Start/End: Complemental strand, 26898544 - 26898513
Alignment:
| Q |
18 |
tcttattcattctcaatcaagagtacaagata |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
26898544 |
tcttattcattctcaatcaagagtacaagata |
26898513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University