View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21280_low_28 (Length: 277)
Name: NF21280_low_28
Description: NF21280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21280_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 40 - 263
Target Start/End: Complemental strand, 52859960 - 52859751
Alignment:
| Q |
40 |
atagtagtactagtattaaaaaagaaacaaaatacggataaaagcctcaacttttggaacaggacataatgactctattcattacattacatacggatta |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
52859960 |
atagtagtactagtattaaaaaagaaacaaaatacggataaaagcctcaacttttggaacatg--------------ttcattacattacatacggatta |
52859875 |
T |
 |
| Q |
140 |
tttggatatctaccggtggatacgacttttacagttttaccccacaataatggaatggaaatggatgttgagaaagaaagtcttgcttggacaaatagaa |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
52859874 |
tttggatatctaccggtggatacgacttttacagttttaccccacaataatggaatggaaatggatgttgagaaagaaagtcttgcttggacaaatacaa |
52859775 |
T |
 |
| Q |
240 |
cacttcaagtttagacacacaaaa |
263 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
52859774 |
cacttcaagtttagacacacaaaa |
52859751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University