View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21280_low_29 (Length: 270)
Name: NF21280_low_29
Description: NF21280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21280_low_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 42144577 - 42144819
Alignment:
| Q |
1 |
ttctgaatattttacatagtactgaatttacctatggtcaacaaagaaactatgagggaccccctctctaatggaatgaatatgagagtaacgccaaaga |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42144577 |
ttctgaatatattacatagtactgaattcacctatggtcaacaa-gaaactatgagggaccccctctctaatggaatgaatatgagagtaacgccaaaga |
42144675 |
T |
|
| Q |
101 |
caattacgtaattttttgcagacaattctgcacaactgcactgatatctggttgaaaatcatatacacatggggactgtaatgtaatctgtgtaactatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42144676 |
caattacgtaattttttgcagacaattctgcacaactgcactgaaatctggttgaaaatcatatacacatggggactgtaatgtaatctgtgtaactatt |
42144775 |
T |
|
| Q |
201 |
gtactactacacaatattaattaaaccacttggtctttggtgta |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42144776 |
gtactactacacaatattaattaaaccacttggtctttggtgta |
42144819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 124 - 220
Target Start/End: Complemental strand, 28377520 - 28377423
Alignment:
| Q |
124 |
aattctgcacaactgcactgatatctggtt-gaaaatcatatacacatggggactgtaatgtaatctgtgtaactattgtactactacacaatattaa |
220 |
Q |
| |
|
||||||||||||||||||| ||| | || || ||||||||| |||||||||||||||||||||||||||||||||| ||||| | ||||||||||| |
|
|
| T |
28377520 |
aattctgcacaactgcactaataacaactttgacaatcatataaacatggggactgtaatgtaatctgtgtaactattatactagtgcacaatattaa |
28377423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University