View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21280_low_34 (Length: 249)
Name: NF21280_low_34
Description: NF21280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21280_low_34 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 64 - 242
Target Start/End: Complemental strand, 40366637 - 40366454
Alignment:
| Q |
64 |
caatcttctcgcaagataatacaattatcaaacacttgataagaaatcaaagaagaaatttaaggtgtttttctttgacaaaaaataaaatttaaggtat |
163 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
40366637 |
caatcttctcccaagataatacaattatcaaacacttgataagaaatcaaagaagcaatttaaggtgtttttctttgacaaaaaataaaatttaaggtgt |
40366538 |
T |
 |
| Q |
164 |
tgagtacatgatttttaaaatatcttc-----nnnnnnnnnnaatttacaagtgtcttgaatacacttgttaatattttctctg |
242 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40366537 |
tgagtacatgatttttaaaatatcttcttctttttttcctttaatttacaagtgtcttgaatacacttgttaacattttctctg |
40366454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 40366660 - 40366628
Alignment:
| Q |
1 |
ttttactatgataatacagttaacaatcttctc |
33 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
40366660 |
ttttactatgataatacagttaacaatcttctc |
40366628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University