View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21281_high_22 (Length: 215)
Name: NF21281_high_22
Description: NF21281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21281_high_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 41 - 202
Target Start/End: Original strand, 5536706 - 5536868
Alignment:
| Q |
41 |
aaccattatttgcactt-aatagaatcaagcaggcaacaagttttgcccccaaacctttttagatggcaaaaccaaaaagggtgtttttccttatgttaa |
139 |
Q |
| |
|
||||||||||| ||||| ||||||| ||||||||||||||||||||||||||| | ||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5536706 |
aaccattatttacacttgaatagaagcaagcaggcaacaagttttgcccccaagcttttttggatggcaaaaccaaaaagggtgattttccttatgttaa |
5536805 |
T |
 |
| Q |
140 |
ccctctggtgcctaagagaattggtccttgtaatctgaagttcagacgtgaagtaagtataat |
202 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5536806 |
ccctatggtgactaagagaattggtccttgtaatctgaagttcagacgtgaagtaagtataat |
5536868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University