View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21281_low_10 (Length: 332)
Name: NF21281_low_10
Description: NF21281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21281_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 10 - 316
Target Start/End: Original strand, 3438610 - 3438916
Alignment:
| Q |
10 |
attattctacagatcgcaacaacccttgtaaaccaactgcactttctggtttatctccctatttgcattttggacagatatctgctcaaagatgtgcttt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3438610 |
attattctacagatcgcaacaacccttgtaaaccaactgcactttctggtttatctccctatttgcattttggacagatatctgctcaaagatgtgcttt |
3438709 |
T |
 |
| Q |
110 |
agaagctcgtaagctacgagcttcatatcctcaggtttgttttactatgctgtttatgttgcttcattttgtttttcctaaaaaagtggtgattaaagat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3438710 |
agaagctcgtaagctacgagcttcatatcctcaggtttgttttactatgctgtttatgttgcttcattttgtttttcctaaaaaagtggtgattaaagat |
3438809 |
T |
 |
| Q |
210 |
cttttcttagacttaactttttctgttcttcaatgttggtgtaaaggctgttgacactttcttggaggagttgattgtgcggagagaacttgctgataac |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3438810 |
cttttcttagacttaactttttctgttcttcaatgttggtgtaaaggctgttgacactttcttggaggagttgattgtgcggagagaacttgctgataac |
3438909 |
T |
 |
| Q |
310 |
ttttgct |
316 |
Q |
| |
|
||||||| |
|
|
| T |
3438910 |
ttttgct |
3438916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University