View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21281_low_15 (Length: 284)
Name: NF21281_low_15
Description: NF21281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21281_low_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 52 - 271
Target Start/End: Complemental strand, 4033604 - 4033385
Alignment:
| Q |
52 |
ctaaggtatattctatctatggagtctacttcaatcaactaacaaagaaggagacaaagtcattcaaatacggacaaattttagctttatgtcctttatt |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4033604 |
ctaaggtatattctatctatggagtctacttcaatcaactaacaaagaaggagacaaagtcattcaaatacggacaaatttgagctttatgtcctttatt |
4033505 |
T |
 |
| Q |
152 |
agtttatttagttttctatgatatcaccccattgatattaactaatttaacaccacttcctacataagcaatctattttgtcaatgtttgatcataagtc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4033504 |
agtttatttagttttctatgatatcaccccattgatattaactaatttaacaccacttcctacataagcaatctattttgtcaatgtttgatcataagtc |
4033405 |
T |
 |
| Q |
252 |
ttaatcacaaaaaggtgtct |
271 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
4033404 |
ttaatcacaaaaaggtgtct |
4033385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University