View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21281_low_16 (Length: 260)
Name: NF21281_low_16
Description: NF21281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21281_low_16 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 18 - 260
Target Start/End: Original strand, 39072382 - 39072624
Alignment:
| Q |
18 |
atatggatcaatctcatgactttgtagaactacattcgttcaattcaattcaaccactttaatttgctgcactgcaccatgcactaccttttcttttcat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39072382 |
atatggatcaatctcatgactttgtagaactacattcgttcaattcaattcaaccactttaatttgctgcactgcaccatgcactaccttttcttttcat |
39072481 |
T |
|
| Q |
118 |
tcatttgtctacatgctttttgcagtgactcccctttcagtaaaaaccccttcctacatatataaattactttcccttttctttctcaattctctccttt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39072482 |
tcatttgtctacatgctttttgcagtgactcccctttcagtaaaaaccccttcctacatatataaattactttcccttttctttctcaattctctccttt |
39072581 |
T |
|
| Q |
218 |
ccttttgggccccctctataccctctaccctccttttcaacca |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
39072582 |
ccttttgggccccctctataccctctaccctctttttcaacca |
39072624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University