View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21281_low_19 (Length: 250)
Name: NF21281_low_19
Description: NF21281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21281_low_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 30 - 150
Target Start/End: Complemental strand, 27154835 - 27154715
Alignment:
| Q |
30 |
taggagatttctccgggggaggcagtgacggaggtggttgtttacggagagaattaggaggagatgataaagcagaagcagaatattgcacattgggcat |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27154835 |
taggagatttctccgggggaggcagtgacggaggtggttgtttacggagagaattaggaggagatgataaagcagaagcagaatattgcacattgggcaa |
27154736 |
T |
|
| Q |
130 |
tggtggcggaggaggtaaagc |
150 |
Q |
| |
|
|||||| |||||||||||||| |
|
|
| T |
27154735 |
tggtggtggaggaggtaaagc |
27154715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University