View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21281_low_23 (Length: 214)
Name: NF21281_low_23
Description: NF21281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21281_low_23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 70 - 190
Target Start/End: Original strand, 33043010 - 33043130
Alignment:
| Q |
70 |
tatcttctaataccatattagagcatgacactcaagagaaaaaactagctgtgattgcaatatgcatttcattattgatcaaatgaactttaaagtaaac |
169 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33043010 |
tatcttctaataccgtattagagcatgacactcgagagaaaaaactagttgtgattgcaatatgcatttcattattgatcaaatgaactttaaagtaaac |
33043109 |
T |
|
| Q |
170 |
gagctagctcaccatacataa |
190 |
Q |
| |
|
||||||||||||||| ||||| |
|
|
| T |
33043110 |
gagctagctcaccatccataa |
33043130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 95 - 161
Target Start/End: Original strand, 33040962 - 33041028
Alignment:
| Q |
95 |
tgacactcaagagaaaaaactagctgtgattgcaatatgcatttcattattgatcaaatgaacttta |
161 |
Q |
| |
|
|||||||||||||| |||| || ||||||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
33040962 |
tgacactcaagagagaaaattaattgtgattgcaagatgcatttcactattgatcatctgaacttta |
33041028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University