View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21281_low_25 (Length: 201)
Name: NF21281_low_25
Description: NF21281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21281_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 3e-93; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 15 - 187
Target Start/End: Complemental strand, 36573521 - 36573349
Alignment:
| Q |
15 |
aatatatattaaatgtccaaattaattcaaagggaatggatggatcatctaaaagctgcaaaaagtttagggattaaataatttgcagctatgaggtttg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36573521 |
aatatatattaaatgtccaaattaattcaaagggaatggatggatcatctaaaagctgcaaaaagtttagggattaaataatttgcagctatgaggtttg |
36573422 |
T |
 |
| Q |
115 |
tcttttcggtaggatgaaatgcatcccaaaacacatatttgcttgcatctttgcatgttagtggattcttctc |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36573421 |
tcttttcggtaggatgaaatgcatcccaaaacacatatttgcttgcatctttgcatgttagtggattcttctc |
36573349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 65 - 172
Target Start/End: Complemental strand, 36578370 - 36578263
Alignment:
| Q |
65 |
aaaagctgcaaaaagtttagggattaaataatttgcagctatgagg-tttgtcttttcggtaggatgaaatgcatcccaaaacacatatttgcttgcatc |
163 |
Q |
| |
|
||||||||| | |||||| |||||||||||||||| || || | | |||||||| || ||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
36578370 |
aaaagctgctagaagtttggggattaaataatttg-agataatacgatttgtcttctcagtaggatgaaatgcatcccaaaacatgtacttgcttgcatc |
36578272 |
T |
 |
| Q |
164 |
tttgcatgt |
172 |
Q |
| |
|
||||||||| |
|
|
| T |
36578271 |
tttgcatgt |
36578263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University