View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21283_high_10 (Length: 253)
Name: NF21283_high_10
Description: NF21283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21283_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 1e-62; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 118 - 243
Target Start/End: Original strand, 35800354 - 35800479
Alignment:
| Q |
118 |
cagtttcacatcaaagatcaatccatgcaaaaactgaagaacgaacgaacctaaaggtggttttccgttataggatgaagaggaggatctccactgaccc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35800354 |
cagtttcacatcaaagatcaatccatgcaaaaactgaagaacgaacgaacctaaaggtggttttccgttataggatgaagaggaggatctccacagaccc |
35800453 |
T |
 |
| Q |
218 |
acttgatgatggttactgatcctttg |
243 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
35800454 |
acttgatgatggttactgatcctttg |
35800479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 35800238 - 35800320
Alignment:
| Q |
1 |
atgtgacagcaactattcacaatatcatgatatatttatcaattctaatttctaacattcacccactttttctactatgcatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35800238 |
atgtgacagcaactattcacaatatcatgatatatttatcaattctaatttctaacattcacccactttttctactatgcatc |
35800320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 160 - 239
Target Start/End: Original strand, 35762586 - 35762662
Alignment:
| Q |
160 |
gaacgaacctaaaggtggttttccgttataggatgaagaggaggatctccactgacccacttgatgatggttactgatcc |
239 |
Q |
| |
|
|||| |||| |||||||| ||||| |||||||| || ||||||| |||| ||||||||||||||||| |||||||||| |
|
|
| T |
35762586 |
gaactaacccaaaggtggctttcctttataggacga---ggaggatttccagtgacccacttgatgatgattactgatcc |
35762662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 197 - 242
Target Start/End: Original strand, 35767904 - 35767949
Alignment:
| Q |
197 |
gaggaggatctccactgacccacttgatgatggttactgatccttt |
242 |
Q |
| |
|
||||||||||||| |||||||||||||||||| || |||||||||| |
|
|
| T |
35767904 |
gaggaggatctcctctgacccacttgatgatgattgctgatccttt |
35767949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 118 - 158
Target Start/End: Original strand, 35790180 - 35790220
Alignment:
| Q |
118 |
cagtttcacatcaaagatcaatccatgcaaaaactgaagaa |
158 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
35790180 |
cagtttgacatcaaagagtaatccatgcaaaaactgaagaa |
35790220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University