View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21283_high_15 (Length: 209)
Name: NF21283_high_15
Description: NF21283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21283_high_15 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 121; Significance: 3e-62; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 37 - 185
Target Start/End: Original strand, 1922483 - 1922631
Alignment:
| Q |
37 |
gaaaggaatgctatattggttgctctaattgtgtgaaacactgttattgcataggcaattcaatcaaacagctcatgatagtttgactaaagttaacaag |
136 |
Q |
| |
|
||||||||| ||||||||||||| |||||| ||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1922483 |
gaaaggaatactatattggttgcactaattatgtaaaacattgttattgcataggcaattcaatcaaacagctcatgatagtttgactaaagttaacaag |
1922582 |
T |
|
| Q |
137 |
tctgcaataaaattgtattcaaatattgtaaacatgtcatgtctgaatg |
185 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
1922583 |
tctgcaataaaattgtattcaaatattgcaaacatgtcatgtatgaatg |
1922631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University