View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21284_high_25 (Length: 402)
Name: NF21284_high_25
Description: NF21284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21284_high_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 363; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 363; E-Value: 0
Query Start/End: Original strand, 19 - 393
Target Start/End: Original strand, 39013325 - 39013699
Alignment:
| Q |
19 |
aaatctaggtgtaagagtataatgaaactcacaattgaacgttgatttgcagatggagagttttctctactatcttcatagcaagattgagattgagaag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39013325 |
aaatctaggtgtaagagtataatgaaactcacaattgaacgttgatttgcggatggagagttttctctactatcttcatagcaagattgagattgagaag |
39013424 |
T |
 |
| Q |
119 |
gcaatggtgaggatacaaatgcaactctatcagaatcatctccaatatcagtgtctctataactccacgttgctgaggatggtgtgtctgctgatgatga |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39013425 |
gcaatggtgaggatacaaatgcaactctatcagaatcatctccaatatcagtgtctctataactccatgttgctgaggatggtgtgtctgctgatgatga |
39013524 |
T |
 |
| Q |
219 |
ggattgacaatcaccaagttcatgatctgagcaactactgatgctttcatgttcatgctcctctaccttctcttcatccatttcttcctcattactcctc |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39013525 |
ggattgacaatcaccaagttcatgatctgagccactactgatgctttcatgttcatgctcctctaccttctcttcatccatttcttcctcattactcctc |
39013624 |
T |
 |
| Q |
319 |
gtctctttttcccttgtgtcacgaaggcgatcgtgataaaatgccatcaattgttttgtatttccttcttcatct |
393 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39013625 |
gtctctttttcccttgtgtcacgaaggcgatcgtgataaaatgccatcaattgttttgtatttccttcttcatct |
39013699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University