View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21284_high_34 (Length: 341)
Name: NF21284_high_34
Description: NF21284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21284_high_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 2e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 20 - 231
Target Start/End: Original strand, 3515935 - 3516146
Alignment:
| Q |
20 |
ctttactccctttccggttagattacacaatgtcaatattgaaagaagaagaagaaagcacaaattagggatctaaataaatattatacgatgatatttg |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3515935 |
ctttactccctttccggttagattacacaatgttaatattgaaagaagaagaagaaagcacaaattagggatctaaataaatattatacgatgatatttg |
3516034 |
T |
 |
| Q |
120 |
tatcgtcatgttggataactataatatccatacccgtcatttattcatttcagtatatattaaatggatgatcgatgaattttaaagtatccctgaatct |
219 |
Q |
| |
|
||| ||||||||||||||||||||||| |||||| ||||| |||||||||| |||||||||||| ||||| ||||||||| |||||||||||| ||| |
|
|
| T |
3516035 |
tattgtcatgttggataactataatattcataccagtcatatattcatttcggtatatattaaacatatgatttatgaattttgaagtatccctgagtct |
3516134 |
T |
 |
| Q |
220 |
ttacgaataccc |
231 |
Q |
| |
|
|| || |||||| |
|
|
| T |
3516135 |
ttccggataccc |
3516146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University