View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21284_high_43 (Length: 318)
Name: NF21284_high_43
Description: NF21284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21284_high_43 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 19 - 301
Target Start/End: Original strand, 45142092 - 45142374
Alignment:
| Q |
19 |
agtggacacaatttggtggtcgatggaggcttctctgttattaatagttgtgttcctactactattaaaaaataagcggtccaatttggaatgtgataaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45142092 |
agtggacacaatttggtggtcgatggaggcttttctgttattaatagttgtgtgcctactactattaaaaaataagtggtccaatttggaatgtgataaa |
45142191 |
T |
|
| Q |
119 |
tatcctacattctgtttctaagtttgttgtaaatttggaatgcgttcctactattagaaaggaaagccttgtaattcttgatcatagtgatgagatcgac |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45142192 |
tatcctacattctgtttctaagtttgttgtaaatttggaatgcgttcctactattagaaaggaaagccttgtaattcttgatcatagtgatgagatcgac |
45142291 |
T |
|
| Q |
219 |
ctcagtgaggatgtaggattcaaattgatccaaacatcgtgttttcatctttactttctgtaatcttttattttgtgtctgtg |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45142292 |
ctcagtgaggatgtaggattcaaattgatccaaacatcgtgttttcatctttactttctgtaatcttttattttgtgtgtgtg |
45142374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 206 - 257
Target Start/End: Complemental strand, 34530995 - 34530943
Alignment:
| Q |
206 |
tgatgagatcgacctcagtgaggatgtaggattcaaa-ttgatccaaacatcg |
257 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||||||||| |||| |
|
|
| T |
34530995 |
tgatgagatcgacctcaacgaggatgtaggattcaaagttgatccaaatatcg |
34530943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000007; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 195 - 230
Target Start/End: Complemental strand, 29361487 - 29361452
Alignment:
| Q |
195 |
cttgatcatagtgatgagatcgacctcagtgaggat |
230 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29361487 |
cttgatcatagtgatgggatcgacctcagtgaggat |
29361452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 195 - 230
Target Start/End: Original strand, 30270623 - 30270658
Alignment:
| Q |
195 |
cttgatcatagtgatgagatcgacctcagtgaggat |
230 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30270623 |
cttgatcatagtgatgggatcgacctcagtgaggat |
30270658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University