View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21284_high_54 (Length: 278)
Name: NF21284_high_54
Description: NF21284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21284_high_54 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 19 - 273
Target Start/End: Complemental strand, 16837438 - 16837184
Alignment:
| Q |
19 |
gtcggttcaattgaattttgggacattacttgttctaatgaagtattaaaaaggaagaatgtggcaagttgcgatgcaatgcttaggatagagagaaaag |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16837438 |
gtcggttcaattgaattttgggacattacttgttctaatgaagtattcaaaaggaagaatgtggcaagttgcgatgcaatgcttaggatagagagaaaag |
16837339 |
T |
|
| Q |
119 |
ataaatattggacagtgacaaagtttgttgaggaccacagccattctctagcttcctctaaaacggagaaacacagtcggccgcgtaggcattttgtagg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16837338 |
ataaatattggacagtgacaaagtttgttgaggaccacagccattctctagcttcctctaaaacggagaaacacagtcggccgcgtaggcattttgtagg |
16837239 |
T |
|
| Q |
219 |
ttctaaaaggaacgttggagagacatccaatgccagtaatgattcctatgcttct |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
16837238 |
ttctaaaaggaacgttggagagacatccaatgccagtaatgattcctatgtttct |
16837184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University