View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21284_high_56 (Length: 270)
Name: NF21284_high_56
Description: NF21284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21284_high_56 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 18 - 257
Target Start/End: Original strand, 1324085 - 1324324
Alignment:
| Q |
18 |
atgttggta-tcaaagcgagttaactcacgctggataccgaatgtgagttaattcatgttgagattannnnnnnaaaatttaaggtgggaatgagcaaaa |
116 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||| ||| |||||| ||||||||||| |
|
|
| T |
1324085 |
atgttggtaatcaaagcgagttaactcacgctggataccgaatgtgagttaatttatgttgagattattttttgaaa-tttgaggtggaaatgagcaaaa |
1324183 |
T |
 |
| Q |
117 |
tgaaaatagagaaaagcaaatttcgaaaatgaaatggccatatgcgacgagacttcattgagccaagagatggtaaccatatgggccgcaatgcccctat |
216 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1324184 |
tgaaaatggagaaaagcaaatttcgagaatgaaatggccatatgcgacgagacttcattgagccaagagatggtaaccatatgggccgcaatgccactat |
1324283 |
T |
 |
| Q |
217 |
ctctcataacaaagtctatactagaattagggatacgacct |
257 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
1324284 |
ctctcataacaaagtctagactagaattagggatacaacct |
1324324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University