View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21284_high_61 (Length: 251)
Name: NF21284_high_61
Description: NF21284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21284_high_61 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 51739451 - 51739692
Alignment:
| Q |
1 |
aagttgtgagcttcttttgtcgaataaatttcatgtttttatttggcttagagatgaatattcaatacgcattgcgtaatctacgtttagtgagcttggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51739451 |
aagttgtgagcttcttttgtcgaataaatttcatgtttttatttggcttagagatgaatattcaatacgcattgcgtaatctacgtttagtgagcttggt |
51739550 |
T |
 |
| Q |
101 |
agcatgtggtggtgtggtaatgggtgtaatttttggtctatctgtctcattttatttatatcaagaattaggcatcgatggttcaaggttttatttctgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51739551 |
agcatgtggtggtgtggtaatgggtgtaatttttggtctatctgtctcattttatttatatcaagaattaggcatcgatggttcaaggttttatttctgt |
51739650 |
T |
 |
| Q |
201 |
atgattattatgttagttgtatcatacacaagttcccctatg |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51739651 |
atgattattatgttagttgtatcatacacaagttcccctatg |
51739692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 10200141 - 10200216
Alignment:
| Q |
1 |
aagttgtgagcttcttttgtcgaataaatttcatgtttttatttggcttagagatgaatattcaatacgcattgcg |
76 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||||||||||||| || ||||||||||| ||| ||||||| |
|
|
| T |
10200141 |
aagtagtgagcttcttttgtcgcataaatttcatgtttttatttggcttggaaatgaatattcactacacattgcg |
10200216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University