View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21284_high_64 (Length: 248)
Name: NF21284_high_64
Description: NF21284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21284_high_64 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 15 - 229
Target Start/End: Original strand, 17108419 - 17108633
Alignment:
| Q |
15 |
aaaggcaaagataattatttatgtcgcattgtcagacaataattctttaggtaaatgtttgcccaattcgtcggataattgtcttttgaatgttttcttg |
114 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
17108419 |
aaaggcaaagataattacttatgtcgcattgtcagacaataattcttcaggtaaatgtttgcccaattcgtcggataactgtcttttgaatgttttcttg |
17108518 |
T |
|
| Q |
115 |
gtctctcttaacgatcgataaatgtgttgtcatctctgttgtttggaagatgctttctcttccttatattaagttcaatacagatgactctttgattgat |
214 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
17108519 |
gtctctcttaaccatcgataaatgtgttgtcatctctgttgtttagaagatgctttcttttccttatattaagttgaatacagatgactctttggttgat |
17108618 |
T |
|
| Q |
215 |
aatatgggggcttgt |
229 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
17108619 |
aatatgggggcttgt |
17108633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University