View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21284_high_69 (Length: 242)

Name: NF21284_high_69
Description: NF21284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21284_high_69
NF21284_high_69
[»] chr8 (1 HSPs)
chr8 (71-224)||(37542676-37542829)


Alignment Details
Target: chr8 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 71 - 224
Target Start/End: Complemental strand, 37542829 - 37542676
Alignment:
71 tgatgggctgacattagaatcttttcagtgaccgtgcgtgcccgataagttagcttcgatccacaattcataaatggccagaaaatgaaaaccataaact 170  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
37542829 tgatgggctgacattagaatcttttcagtgaccgtgcgtgcccgataagttagctttgatccacaattcataaatggccagaaaatgaaaaccataaact 37542730  T
171 gcaacgggaccacgggttaccacaagaagaatccgagaatataactcacttgtt 224  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37542729 gcaacgggaccacgggttaccacaagaagaatccgagaatataactcacttgtt 37542676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University