View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21284_high_83 (Length: 207)
Name: NF21284_high_83
Description: NF21284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21284_high_83 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 41788248 - 41788437
Alignment:
| Q |
1 |
atagaaaatggtagcgtccacatgacactccacataaccctttgctggtggtttccaattcgtatccgtaacaatctgctgtacagcaggagttgccttg |
100 |
Q |
| |
|
||||||||||| ||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41788248 |
atagaaaatggcagcgtccacattacacttcacataaccctttgctggtggtttccaattcgtatccgtaacaatctgttgtacagcaggagttgccttg |
41788347 |
T |
 |
| Q |
101 |
ttgactcgaacagcagatagccattcccttaacgtgtcccgcactagctgaatggatatgtgtggctccttcacctcttcatgccacaccttt |
193 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41788348 |
ttgactcgaa---cagatagccattcccttaacgtgtcccgcgctagctgaatggatatgtgtggctccttcacctcgtcatgccacaccttt |
41788437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 28481306 - 28481253
Alignment:
| Q |
1 |
atagaaaatggtagcgtccacatgacactccacataaccctttgctggtggttt |
54 |
Q |
| |
|
||||||||||| ||||||||||| ||||| |||||||||||||| ||||||||| |
|
|
| T |
28481306 |
atagaaaatggcagcgtccacattacacttcacataaccctttggtggtggttt |
28481253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University