View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21284_low_51 (Length: 317)
Name: NF21284_low_51
Description: NF21284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21284_low_51 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 111; Significance: 5e-56; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 162 - 296
Target Start/End: Complemental strand, 4472867 - 4472733
Alignment:
| Q |
162 |
ctattttgatttctcaattttacttaaataaatgtttaattcaacttctgaattaaagattaactgttaaaaattaagagatcaaaactgtacaacatca |
261 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
4472867 |
ctattttgatttctcaattttacttaaacgaatgttcaattcaacttctgaattaaagattaacggttaaaaattaagagatcaaaactgtacaacatca |
4472768 |
T |
|
| Q |
262 |
atatgtgggtgtgaaccctatatataagtgtatct |
296 |
Q |
| |
|
||| |||||||||||||||||||||| |||||||| |
|
|
| T |
4472767 |
atacgtgggtgtgaaccctatatatatgtgtatct |
4472733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 33 - 138
Target Start/End: Complemental strand, 4473027 - 4472923
Alignment:
| Q |
33 |
caaactaacctgggaaatgtatgatatttgttttagatcaatgaaaatttatattttttcacataaaacttgtgaaatattatttttattaaacgatttg |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4473027 |
caaactaacctgggaaatgtatgatatttgttttagatcaatgaaa-tttatattttttcacataaaacttgtgaaatattatttttattaaacgatttg |
4472929 |
T |
|
| Q |
133 |
ggattt |
138 |
Q |
| |
|
|||||| |
|
|
| T |
4472928 |
ggattt |
4472923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University