View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21284_low_54 (Length: 312)
Name: NF21284_low_54
Description: NF21284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21284_low_54 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 18 - 302
Target Start/End: Original strand, 10275501 - 10275782
Alignment:
| Q |
18 |
ctttgaggcaaccaacctagactcttcataattgcttcattaccaactttgaatggaatcatattttagaccggataatatagacattgtattgcaatgt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10275501 |
ctttgaggcaaccaacctagactcttcataattgcttcattaccatctttgaatggaatcatattttagaccggataatatagacattgtattgcaatgt |
10275600 |
T |
|
| Q |
118 |
catctatgtgaccaatcgtgttattattgtcatcaatatggttgatatgagttggtttgaaatttgaaggataaggttnnnnnnnttattttgcttagtc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
10275601 |
catctatgtgaccaatcgtgttattattgtcatcaatatggttgatatgagttggtttgaaatttgaaggataaggttaaaaaaattattttgcttagtc |
10275700 |
T |
|
| Q |
218 |
cacgacatgaattgatgttaggtatctttacacatttttggctattttttggtacggcaaggatcaatgttttatatcagtataa |
302 |
Q |
| |
|
|| ||||||||||||||||| ||||||||||| ||||||||| |||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
10275701 |
caagacatgaattgatgtta--tatctttacacgtttttggct-ttttttcgtacagcaaggatcaatgttttatatcagtataa |
10275782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University