View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21284_low_59 (Length: 289)
Name: NF21284_low_59
Description: NF21284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21284_low_59 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 141
Target Start/End: Complemental strand, 38189442 - 38189302
Alignment:
| Q |
1 |
tttgtgcatgtttattaaatttttatggtggtggattgcagcgacattcaagtccagggaggatcatcaaaaacagattcagcttgaggaagcctgtaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38189442 |
tttgtgcatgtttattaaatttttatggtggtggattgcagcgacattcaggtccagggaggatcatcaaaaacagattcagcttgaggaagcctgtaaa |
38189343 |
T |
|
| Q |
101 |
tccgggcttgcccctgctgagtttgatgaagatggaaagga |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38189342 |
tccgggcttgcccctgctgagtttgatgaagatggaaagga |
38189302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 136 - 273
Target Start/End: Complemental strand, 38189145 - 38189008
Alignment:
| Q |
136 |
aaaggagacggatatctcatcccaatagtacctcatcaaggagctctagagttactaaaacttttcaggccagcaagtataggaaaggtgcatgtgagaa |
235 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38189145 |
aaaggaaacggatatctcatcccaataatacctcatcaaggagctctagagttactaaaacttttcaggccagcaagtataggaaaggtgcatgtgagaa |
38189046 |
T |
|
| Q |
236 |
gtaagttatctctttcactgttacaaaatgcatctgtg |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38189045 |
gtaagttatctctttcactgttacaaaatgcatgtgtg |
38189008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 57; Significance: 8e-24; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 5 - 141
Target Start/End: Original strand, 38920534 - 38920669
Alignment:
| Q |
5 |
tgcatgtttattaaatttttatggtggtggattgcagcgacattcaagtccagggaggatcatcaaaaacagattcagcttgaggaagcctgtaaatccg |
104 |
Q |
| |
|
|||||||| ||||||||| ||| |||||||||||| | ||||||| ||||| |||||||||| |||||| ||| ||||||||||||| ||||| ||| |
|
|
| T |
38920534 |
tgcatgttaattaaatttgtattc-ggtggattgcagtggcattcaaatccagagaggatcatcgaaaacaaattgagcttgaggaagctcgtaaagccg |
38920632 |
T |
|
| Q |
105 |
ggcttgcccctgctgagtttgatgaagatggaaagga |
141 |
Q |
| |
|
| ||||| ||||||||| ||||||||||||| ||||| |
|
|
| T |
38920633 |
gacttgcacctgctgaggttgatgaagatggcaagga |
38920669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 190 - 254
Target Start/End: Original strand, 38921573 - 38921637
Alignment:
| Q |
190 |
ctaaaacttttcaggccagcaagtataggaaaggtgcatgtgagaagtaagttatctctttcact |
254 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
38921573 |
ctaaaacttttcaggcccagaagtataggaaaggtgcatgtgagaagtaagtgatctctttcact |
38921637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University