View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21284_low_77 (Length: 242)
Name: NF21284_low_77
Description: NF21284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21284_low_77 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 71 - 224
Target Start/End: Complemental strand, 37542829 - 37542676
Alignment:
| Q |
71 |
tgatgggctgacattagaatcttttcagtgaccgtgcgtgcccgataagttagcttcgatccacaattcataaatggccagaaaatgaaaaccataaact |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37542829 |
tgatgggctgacattagaatcttttcagtgaccgtgcgtgcccgataagttagctttgatccacaattcataaatggccagaaaatgaaaaccataaact |
37542730 |
T |
 |
| Q |
171 |
gcaacgggaccacgggttaccacaagaagaatccgagaatataactcacttgtt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37542729 |
gcaacgggaccacgggttaccacaagaagaatccgagaatataactcacttgtt |
37542676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University