View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21284_low_88 (Length: 215)

Name: NF21284_low_88
Description: NF21284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21284_low_88
NF21284_low_88
[»] chr5 (1 HSPs)
chr5 (19-109)||(26162035-26162125)


Alignment Details
Target: chr5 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 19 - 109
Target Start/End: Complemental strand, 26162125 - 26162035
Alignment:
19 gattggagactatatattcaacgtcttgtcttctccgtctacgtcgttgtgtcgtttcctccatccattgcaatttgctttcactctaagg 109  Q
    |||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
26162125 gattggagactatatattcaacgtcttgtcttcttcgtctacgtggttgtgtcgtttcctccatccattgcaatttgctttcactctaagg 26162035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University