View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21284_low_88 (Length: 215)
Name: NF21284_low_88
Description: NF21284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21284_low_88 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 19 - 109
Target Start/End: Complemental strand, 26162125 - 26162035
Alignment:
| Q |
19 |
gattggagactatatattcaacgtcttgtcttctccgtctacgtcgttgtgtcgtttcctccatccattgcaatttgctttcactctaagg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26162125 |
gattggagactatatattcaacgtcttgtcttcttcgtctacgtggttgtgtcgtttcctccatccattgcaatttgctttcactctaagg |
26162035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University