View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21285_low_12 (Length: 223)
Name: NF21285_low_12
Description: NF21285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21285_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 20 - 205
Target Start/End: Original strand, 3601466 - 3601651
Alignment:
| Q |
20 |
atataacaaaataaccatacagagctagctattcatcaaccatggttttatgtattttaatgaagatatagttcatttnnnnnnntgtagatatagttat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3601466 |
atataacaaaataaccatacagagctagctattcatcaaccatggttttatgtattttaatgaagatatagttcatttaaaaaaatgtagatatagttat |
3601565 |
T |
 |
| Q |
120 |
gagcttcnnnnnnnnnattgttttaatgaacccattgaatcttcagcacttatcttatctttatgttgggacattagaggcattat |
205 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3601566 |
gagcttctttttttttattgttttaatgaacccattgaatcttcagcacttatcttatctttatgttgggacattagaggcattat |
3601651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University