View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21285_low_14 (Length: 205)
Name: NF21285_low_14
Description: NF21285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21285_low_14 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 14 - 205
Target Start/End: Complemental strand, 35651472 - 35651281
Alignment:
| Q |
14 |
agaaccaaaccaaccgaatacctaatcagtgatcatcattctttctcactggcataaaataatgtacccacacaaaaaccaaaaggaaatttagaaacta |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
35651472 |
agaaccaaaccaaccgaatacctaatcagtgatcatcattctttctcactggcataaaataatgtacccacataaaaaccaaaaggaaatttagaaacta |
35651373 |
T |
|
| Q |
114 |
gcaaaacatgaaatagtataaaataatgagttaaatttaattaccttcgtatccgtagagcccaacacaatatgagtcaaacatatatatat |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35651372 |
gcaaaacatgaaatagtataaaataatgagttaaatttaattacattcgtatccgtagagcccaacacaatatgagtcaaacatatatatat |
35651281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University