View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21285_low_7 (Length: 380)
Name: NF21285_low_7
Description: NF21285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21285_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 111; Significance: 6e-56; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 111; E-Value: 6e-56
Query Start/End: Original strand, 213 - 362
Target Start/End: Complemental strand, 30854222 - 30854072
Alignment:
| Q |
213 |
tctcagtcaaatgttgagttcagctacattgtgatccttgatattataaaaaatcgcagtcaaatactttttatgcagttttgtatg-nnnnnnnncctt |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
30854222 |
tctcagtcaaatgttgagttcagctacattgtgatccttcatattataaaaaatcgcagtcaaatacattttatgcagttttgtatgtttttttttcctt |
30854123 |
T |
 |
| Q |
312 |
tggattatgatatcatgtaactcctcattattctttatttctcttccaaat |
362 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30854122 |
tggattatgatatcatgtaactcctcattattctttatttctcttccaaat |
30854072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 30854444 - 30854366
Alignment:
| Q |
1 |
catggacaaattaagctggaatctttagacagctagctttagtctatcaccataatatgtgtcttgtcattttgtaaac |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30854444 |
catggacaaattaagctggaatctttagacagctagctttagtctatcaccataatatgtgtcttgtcattttgtaaac |
30854366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 157 - 204
Target Start/End: Complemental strand, 30854288 - 30854241
Alignment:
| Q |
157 |
catgttgtgtcttgcaagttttcctccttaatattttgttcaatcacc |
204 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
30854288 |
catgttgtgccttgcaagttttcctccttaatattttgttcaattacc |
30854241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 30878643 - 30878581
Alignment:
| Q |
1 |
catggacaaattaagctggaatct--ttagacagctagctttagtctatcaccataatatgtg |
61 |
Q |
| |
|
||||||||||||||||| |||||| ||||| |||||||| |||| ||||||||||||||||| |
|
|
| T |
30878643 |
catggacaaattaagctagaatctctttagatagctagctctagtttatcaccataatatgtg |
30878581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 15064237 - 15064309
Alignment:
| Q |
1 |
catggacaaattaagctggaatctttagacagctagctttagtctatcaccataatatgtgtcttgtcatttt |
73 |
Q |
| |
|
||||||||||||||||| |||||| | ||| |||||| |||| |||| |||||||||||||||||||||||| |
|
|
| T |
15064237 |
catggacaaattaagctagaatctctcaacaactagctctagtatatctccataatatgtgtcttgtcatttt |
15064309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 218 - 262
Target Start/End: Original strand, 15064467 - 15064511
Alignment:
| Q |
218 |
gtcaaatgttgagttcagctacattgtgatccttgatattataaa |
262 |
Q |
| |
|
||||||||||| ||||| | ||||||||||||||||||||||||| |
|
|
| T |
15064467 |
gtcaaatgttgtgttcaccaacattgtgatccttgatattataaa |
15064511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 217 - 287
Target Start/End: Original strand, 15076292 - 15076361
Alignment:
| Q |
217 |
agtcaaatgttgagttcagctacattgtgatccttgatattataaaaaatcgcagtcaaatactttttatg |
287 |
Q |
| |
|
|||||||| ||| ||| |||||||||||||||||| ||||||| |||||||||| | ||||| ||| |||| |
|
|
| T |
15076292 |
agtcaaat-ttgtgttgagctacattgtgatccttaatattatgaaaaatcgcacttaaatattttgtatg |
15076361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University