View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21285_low_8 (Length: 355)
Name: NF21285_low_8
Description: NF21285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21285_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 11 - 336
Target Start/End: Complemental strand, 55372927 - 55372607
Alignment:
| Q |
11 |
caaagggaaattggaagagttggaaatggagatcttctaaggattatttttcaaatggtgcttattttataccatctggatatggaacttgtgcaccaaa |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
55372927 |
caaagggaaattggaagagttggaaatggagatcttcaaaggattatttttcaaatggtgcttattttataccatctggatatggaagttgtgcaccaaa |
55372828 |
T |
 |
| Q |
111 |
ttatacacctgctcaatcttttgtggctgttccaggttatatggtacctgctataactctcaatgcaggtccattgagttgttttgttgggaggtcatgt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55372827 |
ttatacacctgctcaatcttttgtggctgttccaggttatatggtacctgctataactctcaatgcaggtccattgagttgttttgttgggaggtcatgt |
55372728 |
T |
 |
| Q |
211 |
taatatagtgaagatatattaatgtatcacatatcacaaattcacagctaatgaaactgctttgcagaaaattagctttctatcatttggcattttcaat |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| |||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
55372727 |
taatatagtgaagatatattaatgtatcacatatcacaagttcacatctaatgaaactgttttgtagaaaattagctttgtatcatttggcattttcaa- |
55372629 |
T |
 |
| Q |
311 |
aggctattattttggataatgcattg |
336 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
55372628 |
----tattattttggataatgcattg |
55372607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University