View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21287_high_12 (Length: 321)
Name: NF21287_high_12
Description: NF21287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21287_high_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 18 - 310
Target Start/End: Original strand, 3983549 - 3983839
Alignment:
| Q |
18 |
catttctatgatcccattgtgatcatcgttcctccaaacaagtcagcctccagttctacaagtacagttactgaattggttgatagattttatggttcag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3983549 |
catttctatgatcccattgtgatcatcgttcctccaaacaagtcagcctccagttctacaagtacagttactgaattggttgatagattttatggttcag |
3983648 |
T |
 |
| Q |
118 |
tcaagaaggtaatatgatcatgtctctttgtccttacatccttctaatggttatgtttttcagtgcaaaactgctgtgcatgatgtctgtctatgaaata |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3983649 |
tcaagaaggtaatatgatcatgtctctttgtccttacatccttctaatggttatgtttttcagtgcaaaactgctgtgcatgatgtctg--tatgaaata |
3983746 |
T |
 |
| Q |
218 |
catttcatttggagttcttttatatgcaggtagtgttggcccgtggttgttttgatgacacaaaggttttagcacatactttttatctttcat |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3983747 |
catttcatttggagttcttttatatgcaggtagtgttggcccgtggttgttttgatgacacaaaggttttagcacatactttttatctttcat |
3983839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University