View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21287_low_17 (Length: 291)
Name: NF21287_low_17
Description: NF21287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21287_low_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 18 - 282
Target Start/End: Complemental strand, 30345523 - 30345258
Alignment:
| Q |
18 |
agatgtgtgcatatagaggtttcttgttttgatttttcttgtgatttgagttgtgtgttgaagttgaaattgaatgttaaggggaaatggtgaagactat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30345523 |
agatgtgtgcatatagaggtttcttgttttgatttttcttgtgatttgagttgtgtgttgaagttgaaattgaatgttaaggggaaatggtgaagactat |
30345424 |
T |
|
| Q |
118 |
gtgaagttttggagaggtaggtacacaaacactgaagcaaagtgcgtttgggttggaatctcttatgaaagtgcgtttttaacgcctgtttttgagcaaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30345423 |
gtgaagttttggagaggtaggtacacaaacactgaagcaaagtgcgtttgggttggaatctcttatgaaagtgcatttttaacgcctgtttttgagcaaa |
30345324 |
T |
|
| Q |
218 |
agtggacattatatgc-ttgagacttatttaacatgcacacaactgttttaggtgtttccctatgc |
282 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30345323 |
agtggactttatatgctttgagacttatttaacatgcacacaactgttttaggtgtttccctatgc |
30345258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University