View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21287_low_27 (Length: 244)
Name: NF21287_low_27
Description: NF21287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21287_low_27 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 1412681 - 1412927
Alignment:
| Q |
1 |
tccagtactcgtccttcaaacaatcatcaacaacccaatgaaaaatggataaattagttatgtttcatttgacaaacttccttattaagttgtaaaatat |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1412681 |
tccagtacccgtccttcaaacaatcatcaacaacccaatgaaaaatggataaattagttatgtttcatttgacaaacttccttattaagttgtaaaatat |
1412780 |
T |
|
| Q |
101 |
ggttgagagtggaactatttgtttgtagtgtgtgtgaattgagaaataaagtagtaagatgaact---------------------agatgttgcagtac |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
1412781 |
ggttgagagtggaactatttgtttgtagtgtgtgtgaattgagaaataaagtagttagatgaactatataatactactagtctttaagatgttacagtac |
1412880 |
T |
|
| Q |
180 |
caaagcaactaactttcacatcaacgagtttaaggatcttgaaagtt |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1412881 |
caaagcaactaactttcacatcaacgagtttaaggatcttgaaagtt |
1412927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University