View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21288_high_12 (Length: 210)
Name: NF21288_high_12
Description: NF21288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21288_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 3e-84; HSPs: 9)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 11 - 196
Target Start/End: Original strand, 35335573 - 35335758
Alignment:
| Q |
11 |
tgaggaggagggtgttgatggcggtgatgggttggaggtttagcatgatgaggaggatgaattggaacatgtttgtgaacaggggcatgagcaggagagt |
110 |
Q |
| |
|
|||| ||||| ||||||||| |||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35335573 |
tgagcaggagtgtgttgatgacggtgatgggttggaggtttagcatggtgaggaggatgaactggaacatgtttgtgaacaggggcatgagcaggagagt |
35335672 |
T |
 |
| Q |
111 |
ggtggtgatgtgttggaggttgaacaggggtgtgagcaggaggatgttgatgatgacgatgggttgggggtttagtatgatgagga |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35335673 |
ggtggtgatgtgttggaggttgaacaggggcgtgagcaggaggatgttgatgatggcgatgggttgggggtttagtatgatgagga |
35335758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 11 - 202
Target Start/End: Original strand, 35335441 - 35335632
Alignment:
| Q |
11 |
tgaggaggagggtgttgatggcggtgatgggttggaggtttagcatgatgaggaggatgaattggaacatgtttgtgaacaggggcatgagcaggagagt |
110 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
35335441 |
tgagtaggagggtgttgatggcgatgatgggttggaggtttagcatgatgaggaggatgaactggaacatgtttgtgaataggagcatgagcaggagagt |
35335540 |
T |
 |
| Q |
111 |
ggtggtgatgtgttggaggttgaacaggggtgtgagcaggaggatgttgatgatgacgatgggttgggggtttagtatgatgaggatgatga |
202 |
Q |
| |
|
| ||| |||||||||||||||||| ||||| |||||||||| ||||||||| | |||||||||| ||||||| ||| |||||| ||||| |
|
|
| T |
35335541 |
gatggcgatgtgttggaggttgaataggggaatgagcaggagtgtgttgatgacggtgatgggttggaggtttagcatggtgaggaggatga |
35335632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 18 - 202
Target Start/End: Original strand, 35335316 - 35335500
Alignment:
| Q |
18 |
gagggtgttgatggcggtgatgggttggaggtttagcatgatgaggaggatgaattggaacatgtttgtgaacaggggcatgagcaggagagtggtggtg |
117 |
Q |
| |
|
||||| |||||||| |||||| ||||||||||| ||||| |||||||||| | ||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
35335316 |
gagggcgttgatggttgtgatgagttggaggttttgcatggcgaggaggatgtactggaacatgtttgtgaacaggggcatgagcaggaggctggtggtg |
35335415 |
T |
 |
| Q |
118 |
atgtgttggaggttgaacaggggtgtgagcaggaggatgttgatgatgacgatgggttgggggtttagtatgatgaggatgatga |
202 |
Q |
| |
|
||| ||||||||||||||||||| |||| |||||| |||||||| || |||||||||| ||||||| |||||||||| ||||| |
|
|
| T |
35335416 |
atgcgttggaggttgaacaggggaatgagtaggagggtgttgatggcgatgatgggttggaggtttagcatgatgaggaggatga |
35335500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 117 - 184
Target Start/End: Complemental strand, 16592096 - 16592029
Alignment:
| Q |
117 |
gatgtgttggaggttgaacaggggtgtgagcaggaggatgttgatgatgacgatgggttgggggttta |
184 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||| |||||||| || |||||||||| |||||| |
|
|
| T |
16592096 |
gatgggttggaggttgaacaggggcatgagcaggagggtgttgatggtggtgatgggttggaggttta |
16592029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 62 - 134
Target Start/End: Original strand, 35335231 - 35335300
Alignment:
| Q |
62 |
ggaggatgaattggaacatgtttgtgaacaggggcatgagcaggagagtggtggtgatgtgttggaggttgaa |
134 |
Q |
| |
|
||||| |||||||||| ||||||||| ||||||| |||||||||| |||||||||||||||| ||||||| |
|
|
| T |
35335231 |
ggagggtgaattggaatgtgtttgtgagcaggggcgtgagcaggag---ggtggtgatgtgttggtggttgaa |
35335300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 11 - 52
Target Start/End: Complemental strand, 16592070 - 16592029
Alignment:
| Q |
11 |
tgaggaggagggtgttgatggcggtgatgggttggaggttta |
52 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
16592070 |
tgagcaggagggtgttgatggtggtgatgggttggaggttta |
16592029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 117 - 194
Target Start/End: Complemental strand, 16602546 - 16602469
Alignment:
| Q |
117 |
gatgtgttggaggttgaacaggggtgtgagcaggaggatgttgatgatgacgatgggttgggggtttagtatgatgag |
194 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||| |||||||| | |||||||||| ||||||| ||| |||| |
|
|
| T |
16602546 |
gatgggttggaggttgaacaggggcatgagcaggagggtgttgatggtagggatgggttggaggtttagcatggtgag |
16602469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 11 - 62
Target Start/End: Complemental strand, 16602520 - 16602469
Alignment:
| Q |
11 |
tgaggaggagggtgttgatggcggtgatgggttggaggtttagcatgatgag |
62 |
Q |
| |
|
|||| |||||||||||||||| | |||||||||||||||||||||| |||| |
|
|
| T |
16602520 |
tgagcaggagggtgttgatggtagggatgggttggaggtttagcatggtgag |
16602469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 11 - 55
Target Start/End: Complemental strand, 16591950 - 16591906
Alignment:
| Q |
11 |
tgaggaggagggtgttgatggcggtgatgggttggaggtttagca |
55 |
Q |
| |
|
|||| |||||||||||| ||| ||||| ||||||||||||||||| |
|
|
| T |
16591950 |
tgagcaggagggtgttggtggtggtgacgggttggaggtttagca |
16591906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 69
Target Start/End: Original strand, 24541009 - 24541055
Alignment:
| Q |
23 |
tgttgatggcggtgatgggttggaggtttagcatgatgaggaggatg |
69 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||| | ||||||||||| |
|
|
| T |
24541009 |
tgttggtggcggtgatgggttggaggtttggcagggtgaggaggatg |
24541055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University