View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21288_high_6 (Length: 287)
Name: NF21288_high_6
Description: NF21288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21288_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 36 - 272
Target Start/End: Complemental strand, 10843025 - 10842789
Alignment:
| Q |
36 |
catcgtaaataggaaaagaatgagggtaaaagnnnnnnntcttcaacttgtttgggtttttatctctttagagactctcaagaaatcatcaatttcttta |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10843025 |
catcgtaaataggaaaagaatgagggtaaaagaaaaaaatcttcaacttgtttgggtttttctttctttagagactctcaagaaatcatcaatttcttta |
10842926 |
T |
 |
| Q |
136 |
cttgaccttgtagnnnnnnnnnnnnnnnnnnnnnnnggttaaagtcattgtcaaaagtttgttcttctgacatccgacttaaatcatggtccaattggga |
235 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10842925 |
cttgaccttgtagttttatgttttcttttttattttggttaaagtcattctcaaaagtttgttcttctaacatccgacttaaatcatggtccaattggga |
10842826 |
T |
 |
| Q |
236 |
gacttgagctttgagatttttggtagtgtttttgcat |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10842825 |
gacttgagctttgagatttttggtagtgtttttgcat |
10842789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University