View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21288_high_9 (Length: 272)

Name: NF21288_high_9
Description: NF21288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21288_high_9
NF21288_high_9
[»] chr4 (1 HSPs)
chr4 (17-258)||(44494803-44495047)


Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 17 - 258
Target Start/End: Complemental strand, 44495047 - 44494803
Alignment:
17 cttggaaagttaaatatggcgtggggtatggctttcaagggaaaagacgagctatgttaagacgagaggttatggtagtgttgcagggaaaagattgctt 116  Q
    ||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44495047 cttggaaggttaaatatggcgtgcggtatggctttcaagggaaaagacgagctatgttaagacgagaggttatggtagtgttgcagggaaaagattgctt 44494948  T
117 caacaaatcaatagtttgcttgagatggattgggaggtcaagatttatc-ttttttataggaaagtgaaattttattcaggtgttagccaatatagggtg 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||    
44494947 caacaaatcaatagtttgcttgagatggattgggaggtcaagatttatcattttttataggaaagtgaaattttatgcaggtgttagccaatatagggtg 44494848  T
216 t--gaccaaggttctactatggttcgtaccaccaaatctctgctc 258  Q
    |  |||||||||||||||||||||||||| |||||||||||||||    
44494847 tgagaccaaggttctactatggttcgtacgaccaaatctctgctc 44494803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University