View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21288_low_11 (Length: 272)
Name: NF21288_low_11
Description: NF21288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21288_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 17 - 258
Target Start/End: Complemental strand, 44495047 - 44494803
Alignment:
| Q |
17 |
cttggaaagttaaatatggcgtggggtatggctttcaagggaaaagacgagctatgttaagacgagaggttatggtagtgttgcagggaaaagattgctt |
116 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44495047 |
cttggaaggttaaatatggcgtgcggtatggctttcaagggaaaagacgagctatgttaagacgagaggttatggtagtgttgcagggaaaagattgctt |
44494948 |
T |
|
| Q |
117 |
caacaaatcaatagtttgcttgagatggattgggaggtcaagatttatc-ttttttataggaaagtgaaattttattcaggtgttagccaatatagggtg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44494947 |
caacaaatcaatagtttgcttgagatggattgggaggtcaagatttatcattttttataggaaagtgaaattttatgcaggtgttagccaatatagggtg |
44494848 |
T |
|
| Q |
216 |
t--gaccaaggttctactatggttcgtaccaccaaatctctgctc |
258 |
Q |
| |
|
| |||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
44494847 |
tgagaccaaggttctactatggttcgtacgaccaaatctctgctc |
44494803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University