View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21288_low_9 (Length: 285)
Name: NF21288_low_9
Description: NF21288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21288_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 16 - 269
Target Start/End: Complemental strand, 33251974 - 33251721
Alignment:
| Q |
16 |
aatatctcagccccacaactataccacgtgtattatatttacctcatttcatacaaaatatccacatctcacgcaacaagtacaaagacaaatatcttgt |
115 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33251974 |
aatatctcagccccacaaccataccacgtgtattatatttacctcatttcatacaaaatatccacatctcatgcaacaagtacaaagacaaatatcttgt |
33251875 |
T |
|
| Q |
116 |
acaagaacattcgagagttagcatgtgcatgttccgtggtcaccactacaatcgtgttaacaataataataaggataatgttgtttcttagatatttttg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33251874 |
acaagaacattcgagagttagcatgtgcatgttccgtggtcaccactacaatcgtgttaacaacaataataaggataatgttgtttcttagatatttttg |
33251775 |
T |
|
| Q |
216 |
cgcaacttctagagcattcctttcctaattaaccgactttaactcccaataaat |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33251774 |
cgcaacttctagagcattcctttcctaattaaccgactttaactcccaataaat |
33251721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University