View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21289_high_12 (Length: 227)
Name: NF21289_high_12
Description: NF21289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21289_high_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 19 - 213
Target Start/End: Complemental strand, 32122515 - 32122321
Alignment:
| Q |
19 |
ggtttagggtcaaatttcatactctcttgactccaattcaaaagaagcattagcataatattaagttctagcagtggaagtagtattctttatgggaagg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32122515 |
ggtttagggtcaaatttcatactctcttgactccgattcaaaagaagcattagcataatattaagttctagcagtggaagtagtattctttatgggaagg |
32122416 |
T |
|
| Q |
119 |
tgaatcatcacatgccatttgactcttttcaggataaaataaaaagaaattatgttttaacatcaaaattttgatgtcaaatacggtgccctttg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32122415 |
tgaatcatcacatgccatttgactcttttcaggataaaataaaaagaaatgatgttttaacatcaaaattttgatgtcaaatacggtgccctttg |
32122321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 165 - 202
Target Start/End: Original strand, 18433662 - 18433699
Alignment:
| Q |
165 |
aaattatgttttaacatcaaaattttgatgtcaaatac |
202 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
18433662 |
aaattatattttaacatcaaaattttgatgtcaaatac |
18433699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University