View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21289_low_11 (Length: 249)
Name: NF21289_low_11
Description: NF21289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21289_low_11 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 20 - 249
Target Start/End: Complemental strand, 2230803 - 2230571
Alignment:
| Q |
20 |
gaaacgaacacgttaatgtctgcctttttgtgttgacaaaatgttaatttcagccttaatgatagtaaattaatacgaatatcgagttttcnnnnnnnnn |
119 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
2230803 |
gaaacgaacacgttaatgtctgcctatttgtgttgacaaaatgttaatgtcagccttaatgatagtaaattaatacgaatactgaattttcaacaaaaaa |
2230704 |
T |
|
| Q |
120 |
---tgaatacaaattatatttatgtttggtaaaaaacgatatttatatcaagataaaaatgcaaagataatgttaggtcagtattttataatattagaaa |
216 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2230703 |
atataaatacaaattatatttatgtttggtaaaaaacgatatttatatcaagataaaaatgcaaagataatgttacgtcagtattttataatattagaaa |
2230604 |
T |
|
| Q |
217 |
tgtgaatttgaagtcaaatatccaaatctgatt |
249 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
2230603 |
tgtgaatttgaagtcaaatatccatatctgatt |
2230571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University