View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21289_low_12 (Length: 239)
Name: NF21289_low_12
Description: NF21289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21289_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 137; Significance: 1e-71; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 61 - 222
Target Start/End: Complemental strand, 2230337 - 2230174
Alignment:
| Q |
61 |
gtcattatttgtaatcaatttcctaagcaaacatcttgctaattgtcacaccatctttaagctaaatt--aagttaccgcgaaaattcaggatgataaac |
158 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
2230337 |
gtcattatttgtaatcaatttccgaagcaaacatcttgctaattgtcacaccatctttaagctaaattccaagttaccgcaaaaattcaggatgataaat |
2230238 |
T |
 |
| Q |
159 |
actatcctttgtttgcttttgttttgtgttcatgtggtattagtttttgcttcaagcttacaat |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2230237 |
actatcctttgtttgcttttgttttgtgttcatgtggtactagtttttgcttcaagcttacaat |
2230174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 73 - 216
Target Start/End: Complemental strand, 2239251 - 2239106
Alignment:
| Q |
73 |
aatcaatttcctaagcaaacatcttgctaattgtcacaccatctttaagctaaatt--aagttaccgcgaaaattcaggatgataaacactatcctttgt |
170 |
Q |
| |
|
||||||||| || | ||||| ||||||||||||||||| |||||| | | ||| || | || |||| |||||||| |||| ||||| | |||||||| |
|
|
| T |
2239251 |
aatcaatttacttaacaaacttcttgctaattgtcacatcatcttcatgttaagtttcatgtctccgctaaaattcaccatgacaaacattgtcctttgt |
2239152 |
T |
 |
| Q |
171 |
ttgcttttgttttgtgttcatgtggtattagtttttgcttcaagct |
216 |
Q |
| |
|
|| ||||||||||||||||||||| ||||| |||||||| |||||| |
|
|
| T |
2239151 |
ttacttttgttttgtgttcatgtgatattaatttttgctgcaagct |
2239106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 2230391 - 2230354
Alignment:
| Q |
1 |
tatttatatgagttatttgtcaccggaaaaaatttgtg |
38 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2230391 |
tatttatatgagttatttgtcaccggaaaaaatttgtg |
2230354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University