View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21289_low_13 (Length: 228)

Name: NF21289_low_13
Description: NF21289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21289_low_13
NF21289_low_13
[»] chr8 (2 HSPs)
chr8 (77-228)||(40494236-40494385)
chr8 (6-78)||(40494645-40494717)


Alignment Details
Target: chr8 (Bit Score: 119; Significance: 6e-61; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 77 - 228
Target Start/End: Complemental strand, 40494385 - 40494236
Alignment:
77 taatttattaatcaatcgatacaataacaaacatcaacaaaaggatgaaatcaaaataaatatgtggcaaccttgactaaagtatgaacta-cctatttg 175  Q
    ||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||    
40494385 taatttattaatcaatcgatacaataaaaaacatcaacgaaaggatgaaatcaaaataaatatgtggcaaccttgactaaagtatgagctaccctatttg 40494286  T
176 ctctctttctttcttttttaaatctgtattaactcttatcctaacaaactcaa 228  Q
    ||||||||||   ||||||||||||||||||||||||||||||||||||||||    
40494285 ctctctttct---ttttttaaatctgtattaactcttatcctaacaaactcaa 40494236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 6 - 78
Target Start/End: Complemental strand, 40494717 - 40494645
Alignment:
6 atttcttactcttgcatttgcttggattagcctattgtcaactgcttttttcttccaggggtacaatcatata 78  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
40494717 atttctcactcttgcatttgcttggattagcctattgtcaactgcttttttcttccatgggtacaatcatata 40494645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University