View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21289_low_13 (Length: 228)
Name: NF21289_low_13
Description: NF21289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21289_low_13 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 119; Significance: 6e-61; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 77 - 228
Target Start/End: Complemental strand, 40494385 - 40494236
Alignment:
| Q |
77 |
taatttattaatcaatcgatacaataacaaacatcaacaaaaggatgaaatcaaaataaatatgtggcaaccttgactaaagtatgaacta-cctatttg |
175 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
40494385 |
taatttattaatcaatcgatacaataaaaaacatcaacgaaaggatgaaatcaaaataaatatgtggcaaccttgactaaagtatgagctaccctatttg |
40494286 |
T |
|
| Q |
176 |
ctctctttctttcttttttaaatctgtattaactcttatcctaacaaactcaa |
228 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40494285 |
ctctctttct---ttttttaaatctgtattaactcttatcctaacaaactcaa |
40494236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 6 - 78
Target Start/End: Complemental strand, 40494717 - 40494645
Alignment:
| Q |
6 |
atttcttactcttgcatttgcttggattagcctattgtcaactgcttttttcttccaggggtacaatcatata |
78 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40494717 |
atttctcactcttgcatttgcttggattagcctattgtcaactgcttttttcttccatgggtacaatcatata |
40494645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University