View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2128_high_13 (Length: 205)

Name: NF2128_high_13
Description: NF2128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2128_high_13
NF2128_high_13
[»] chr8 (1 HSPs)
chr8 (16-191)||(44299164-44299339)


Alignment Details
Target: chr8 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 16 - 191
Target Start/End: Original strand, 44299164 - 44299339
Alignment:
16 atgaatctggcatcacgtgcatgtaaccggtagcgagtataacaccggaggcaaaagccttaacgatcacgaataaatctccgtcgggttttaacgctgg 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||    
44299164 atgaatctggcatcacgtgcatgtaaccggtagcgagtataacaccggaggcaaaagccttaatgatcacgaataaatctccgtcgggttttaatgctgg 44299263  T
116 gatcgaagttgtgaaaattggaatacaaattccaatcatgctcgtcactaatatggaaaatattgcaattaatttt 191  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44299264 gatcgaagttgtgaaaattggaatacaaattccaatcatgctcgtcactaatatggaaaatattgcaattaatttt 44299339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University