View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2128_low_16 (Length: 239)
Name: NF2128_low_16
Description: NF2128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2128_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 39 - 228
Target Start/End: Original strand, 48033200 - 48033392
Alignment:
| Q |
39 |
acaaactaaaactctcaattttgtgtatgttt----acatgtgtgtgagtttaatttattgaaacggtaacgttcgcaaaaaattgcggcgattcaaagt |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
48033200 |
acaaactaaaactctcaattttgtgtatgtttgtttacatgtgtgtgaatttaatttattgaaacggtagcgttcgcaaaa-attgcggcgattcaaagt |
48033298 |
T |
|
| Q |
135 |
tcaaaccatactcaccatgaatccaaacaacttttgatttctcaatgttttatcaggtaattcatcttctccaattccattcccttactatatt |
228 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48033299 |
tcaaaccatcctcaccatgaatccaaacaacttttgatttgtcaatgttttatcaggtaattcatcttctccaattccattcccttactatatt |
48033392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University