View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21290_high_8 (Length: 309)
Name: NF21290_high_8
Description: NF21290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21290_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 96 - 298
Target Start/End: Complemental strand, 3015909 - 3015707
Alignment:
| Q |
96 |
catggttctgtgacttcttggtttacctgcatgaatagttcacttgaatatatgtatggcaacatgaaatgccttgaagaaaaaggcatcaacaaacaaa |
195 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3015909 |
catggttctgtgacttctttgtttacctgcatgaatagttcacttgaatatatgtatggcaacatgaaatgccttgaagaaaaaggcaccaacaaacaaa |
3015810 |
T |
 |
| Q |
196 |
ttcccattttctgctgctagctcatgcagcatgttccttgacatatcagaatgcataaaatctaatactctctaagattctttgtttaataacgatgatg |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3015809 |
ttcccattttctgctgctagctcatgcagcatgttccttgacatttcagaatgcataaaatctaatactctctaagattctttgtttaataacgatgatg |
3015710 |
T |
 |
| Q |
296 |
atg |
298 |
Q |
| |
|
||| |
|
|
| T |
3015709 |
atg |
3015707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 19 - 69
Target Start/End: Complemental strand, 3015986 - 3015936
Alignment:
| Q |
19 |
gttgtcatgtttgaacttgttctcactattattacaattccatggaaatcc |
69 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3015986 |
gttgtcatgtttgaacttgttctcactattattacaattccatggagatcc |
3015936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University