View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21290_low_9 (Length: 277)
Name: NF21290_low_9
Description: NF21290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21290_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 55; Significance: 1e-22; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 203 - 261
Target Start/End: Original strand, 44193933 - 44193991
Alignment:
| Q |
203 |
tgtcatgaacaacgttttcttttcttttggtagtaacggtgttttgttgcggctgtgac |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44193933 |
tgtcatgaacaacgttttcttttcttttggtagtaacggtgtttcgttgcggctgtgac |
44193991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 37 - 180
Target Start/End: Original strand, 44307768 - 44307907
Alignment:
| Q |
37 |
gttggtgtgaattacttacaacattacaccagtcttatgtaatgtataattgaagatagatttgaagttctaaactagagaaagagcgaatttaaaacat |
136 |
Q |
| |
|
|||||||||||||| |||||| ||||||||| | ||||||| ||||||||| |||||| |||||||||| ||||||| ||||| ||| |||| | |
|
|
| T |
44307768 |
gttggtgtgaattaattacaatattacaccacttttatgtattgtataattaaagatatatttgaagttataaactaaagaaatagc----ctaaatgag |
44307863 |
T |
 |
| Q |
137 |
atagttatgcactaaaaatgtgattttcatccatctcaattaaa |
180 |
Q |
| |
|
||| ||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
44307864 |
ataaatatatactaaaaatgtgattttcatccatcccaattaaa |
44307907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 40 - 113
Target Start/End: Original strand, 44314850 - 44314923
Alignment:
| Q |
40 |
ggtgtgaattacttacaacattacaccagtcttatgtaatgtataattgaagatagatttgaagttctaaacta |
113 |
Q |
| |
|
||||||||||| |||||| || ||| || | ||||||||| ||||| | |||||||||||||||||| |||||| |
|
|
| T |
44314850 |
ggtgtgaattaattacaatatcacatcacttttatgtaatctataactaaagatagatttgaagttcaaaacta |
44314923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000006; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 142 - 186
Target Start/End: Complemental strand, 33049155 - 33049111
Alignment:
| Q |
142 |
tatgcactaaaaatgtgattttcatccatctcaattaaaaaataa |
186 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33049155 |
tatgtactaaaaatgtgattttcatccatctcaattgaaaaataa |
33049111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 149 - 185
Target Start/End: Complemental strand, 31742910 - 31742874
Alignment:
| Q |
149 |
taaaaatgtgattttcatccatctcaattaaaaaata |
185 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31742910 |
taaaaatgtgattttcatccatctcaattgaaaaata |
31742874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 142 - 183
Target Start/End: Original strand, 14867383 - 14867424
Alignment:
| Q |
142 |
tatgcactaaaaatgtgattttcatccatctcaattaaaaaa |
183 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
14867383 |
tatgtactaaaaatgtgattttcatccatctcaattgaaaaa |
14867424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 186
Target Start/End: Original strand, 14355017 - 14355054
Alignment:
| Q |
149 |
taaaaatgtgattttcatccatctcaattaaaaaataa |
186 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14355017 |
taaaaatgtgattttcatccatctcaattgaaaaataa |
14355054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 147 - 185
Target Start/End: Complemental strand, 46475615 - 46475577
Alignment:
| Q |
147 |
actaaaaatgtgattttcatccatctcaattaaaaaata |
185 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
46475615 |
actaaaaatgtgattttcatccatatcaattgaaaaata |
46475577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 92 - 121
Target Start/End: Original strand, 26537327 - 26537356
Alignment:
| Q |
92 |
atagatttgaagttctaaactagagaaaga |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
26537327 |
atagatttgaagttctaaactagagaaaga |
26537356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 147 - 188
Target Start/End: Complemental strand, 53527095 - 53527054
Alignment:
| Q |
147 |
actaaaaatgtgattttcatccatctcaattaaaaaataacg |
188 |
Q |
| |
|
||||||||||| ||||||||||| ||||||| |||||||||| |
|
|
| T |
53527095 |
actaaaaatgtcattttcatccacctcaattgaaaaataacg |
53527054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University