View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21291_low_3 (Length: 396)
Name: NF21291_low_3
Description: NF21291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21291_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 7 - 380
Target Start/End: Original strand, 49063840 - 49064213
Alignment:
| Q |
7 |
tggtggattaaaagtggacatcttttgagtactttgatacatggatatctaatttaaagaannnnnnnnnncattggaagaaagtggagggaatgcatca |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
49063840 |
tggtggattaaaagtggacatcttttgagtactttgatatatggatatctaatttaaaga-ttttttttttcattggaagaaagtggagggaatgcatca |
49063938 |
T |
|
| Q |
107 |
aaatcaaacattgtgacaatctttttgggggatttcggatgtggaagatagtttggactaaagatagcgaaatctttgaaagatatttggtccctatgca |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
49063939 |
aaatcaaacattgtgacaatctttttgggggatttcggatgtggaagatagtttggactaaagatagcgaaatctttgaaagatatttggttcctatgca |
49064038 |
T |
|
| Q |
207 |
cttatcagacagctaacgatgcgatatgctaaaatggaatcgtatataaacttactcatgaaccgtgataatttcaaatggggctagc-actttgataat |
305 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| |||||||| | ||||||||| |
|
|
| T |
49064039 |
cttatcagacagctaacgatgtgatatgctaaaatggaatcatatataaacttactcatgaaccgtgatcatttcaaattgggctagcaagtttgataat |
49064138 |
T |
|
| Q |
306 |
ctaaattatgtaaagtgccttgtgattgtggaagattaatcaattgagctatcatgcttaagctgtgttggatgt |
380 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49064139 |
ctaaattatgtaaactgccttgtgattgtggaagattaatcaattgagctatcatgcttaagctgtgttggatgt |
49064213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University