View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21293_high_14 (Length: 312)
Name: NF21293_high_14
Description: NF21293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21293_high_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 20 - 294
Target Start/End: Complemental strand, 43882899 - 43882625
Alignment:
| Q |
20 |
acagatacagcataaatcgagagaatttcattttaacatgcatatacctgatgatttctttgaggggtcctttgctacagctgtggtagatgagattcgg |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43882899 |
acagatacagcataaatcgagagaatttcattttaacttgcatatacctgatgatttctttgaggggtcctttgctacagctgtggtagatgagattcgg |
43882800 |
T |
 |
| Q |
120 |
ccaaatttccttaccgcttgaacagttctggatattactttggacctgcaaaacacagatcaaaattttaaccataaatatcacatatacattaatttta |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43882799 |
ccaaatttccttaccgcttgaacagttctggatattactttggacctgcaaaacacagatcaaaattttaaccataaatatcacatatacattaatttta |
43882700 |
T |
 |
| Q |
220 |
gacttgacttctaagcgatgcatatgttgttcctctgcaaatatgctgtaatagcataagcactactcacgtctt |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43882699 |
gacttgacttctaagcgatgcatatgttgttcctctgcaaatatgctgtaatagcataagcactactcacgtctt |
43882625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University