View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21293_high_26 (Length: 247)
Name: NF21293_high_26
Description: NF21293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21293_high_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 124 - 228
Target Start/End: Original strand, 30652931 - 30653032
Alignment:
| Q |
124 |
gagccgataatgcgacatgtaaatgagtgacaaaaattgtaaactttgttatggttattatgatatacattttctgtcacttaattattatcttttagaa |
223 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30652931 |
gagcctataatacgacatgtaaatgagtgacaaaaattctaaactttgttatggttat---gatatacattttctgtcacttaattattatcttttagaa |
30653027 |
T |
|
| Q |
224 |
tatct |
228 |
Q |
| |
|
||||| |
|
|
| T |
30653028 |
tatct |
30653032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 30652761 - 30652812
Alignment:
| Q |
1 |
ctctttttgttgagatatttttggcactcatatcatatataacatagtaaaat |
53 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||| ||||||||||||||||||| |
|
|
| T |
30652761 |
ctctttttgttgagatattttt-gcactgatatgatatataacatagtaaaat |
30652812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University